Review



chimeric guide rna expression plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc chimeric guide rna expression plasmid
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Chimeric Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2984 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pmc12803845-387-29-34?v=Addgene+inc
    Average 96 stars, based on 2984 article reviews
    chimeric guide rna expression plasmid - by Bioz Stars, 2026-08
    96/100 stars

    Images

    1) Product Images from "A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion"

    Article Title: A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion

    Journal: iScience

    doi: 10.1016/j.isci.2025.114443

    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Figure Legend Snippet: Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

    Techniques Used: Derivative Assay, RNA Sequencing, Standard Deviation, RNA Expression, Expressing, Flow Cytometry, Immunofluorescence, Staining, Co-Culture Assay



    Similar Products

    96
    Addgene inc chimeric guide rna expression plasmid
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Chimeric Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pmc12803845-387-29-34?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    chimeric guide rna expression plasmid - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    93
    Addgene inc aav u6 sgrna hsyn mcherry vectors expressed single guide rna sgrna
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Aav U6 Sgrna Hsyn Mcherry Vectors Expressed Single Guide Rna Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/bio_rxiv__64898__2025__12__10__693421-51-0-7?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    aav u6 sgrna hsyn mcherry vectors expressed single guide rna sgrna - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    95
    Addgene inc mlm3636 guide rna expression plasmid
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Mlm3636 Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pmc12501846__pgaf297_supplementary_data-7-35-49?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    mlm3636 guide rna expression plasmid - by Bioz Stars, 2026-08
    95/100 stars
      Buy from Supplier

    96
    Addgene inc guide rna expression plasmid lenti crispr v2
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Expression Plasmid Lenti Crispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pmc12456019-240-28-33?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid lenti crispr v2 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    95
    Addgene inc guide rna lentiviral expression vector
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Lentiviral Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pmc10372678__pnas__2305187120__sapp-96-17-22?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    guide rna lentiviral expression vector - by Bioz Stars, 2026-08
    95/100 stars
      Buy from Supplier

    96
    Addgene inc guide rna expression plasmid px459
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Expression Plasmid Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pm40641422-437-13-20?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid px459 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc guide rna expression plasmid lentiguide puro
    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
    Guide Rna Expression Plasmid Lentiguide Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid/pmc12210241-581-14-18?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid lentiguide puro - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    Image Search Results


    Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

    Journal: iScience

    Article Title: A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion

    doi: 10.1016/j.isci.2025.114443

    Figure Lengend Snippet: Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

    Article Snippet: For generation of fluorescently-tagged hPSC lines EGFP or tdTM was inserted into the AAVS1 locus with a targeting plasmid (Addgene; catalog no. 22212) and a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid (Addgene; catalog no. 42230), into which the Target Guide Sequence was cloned into using the oligos: Oligo 1: CACCG GGGGCCACTAGGGACAGGAT,Oligo2 : AAAC ATCCTGTCCCTAGTGGCCCC C. After puromycin selection, EGFP or tdTM-expressing clones were manually picked.

    Techniques: Derivative Assay, RNA Sequencing, Standard Deviation, RNA Expression, Expressing, Flow Cytometry, Immunofluorescence, Staining, Co-Culture Assay